rs789661 chr1:232548393 T>C
- Sequence
ccacctccatttgcttccaacctc[T/C]gtacatacttgtctcaattcataa
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.13 | -0.53 | 3.76 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP decrease in fev1 (in asthmatic participants >=30 years old), diastolic blood pressure (dbp), lung function, forced expiratory volume in 1 second (fev1) percent predicted (in asthmatic participants), lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc) ratio percent predicted (in asthmatic participants), microalbuminuria, obesity with early age of onset (age >2), rheumatoid arthritis, systolic blood pressure (sbp)