rs78978101 chr12:130026756 C>A
- Sequence
ctcgtctcatcctcgtataactta[C/A]ctggagcagcttagcctctaggtg
- ASB in cell types
- hASC (preadipocytes) PC9 (lung adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| hASC (preadipocytes) | -0.66 | 1.86 | 1.00 | |||
| PC9 (lung adenocarcinoma) | 1.37 | -0.28 | 1.83 |
Items per page:
1 – 2 of 2