rs790086 chr17:73591886 A>T
- Sequence
cctcatcttcaaagagcatcaagc[A/T]ctaaaacggtaagagtggccaggt
- ASB in cell types
- GM12878 (female B-cells) T47D (invasive ductal carcinoma)
- ASB for transcription factors
- MEF2B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEF2B_HUMAN | 1.86 | -1.50 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, diastolic blood pressure (dbp), obesity with early age of onset (age >2), serum creatinine