rs7901463 chr10:58412618 C>T
- Sequence
ctctttttctaagtgtttctccat[C/T]tatgatctcacttttgtggctaga
- ASB in cell types
- A549 (lung carcinoma)
- ASB for transcription factors
- GATA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA3_HUMAN | 1.70 | -1.94 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, emergence of suicidal ideation during treatment with antidepressants, emergence of suicidal ideation during treatment with antidepressants (broad definition - no increase in suicide ideation), emergence of suicidal ideation during treatment with antidepressants (narrow definition - emergence from suicidal ideation absent at baseline), hdl cholesterol change with statins, urinary albumin-to-creatinine ratio, years of education