rs7901640 chr10:18368024 G>A
- Sequence
tttttaggtgcgtttgggggtaca[G/A]tagaatgagattatttcacttttt
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells)
- ASB for transcription factors
- RING2_HUMAN SRF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RING2_HUMAN | 2.28 | -2.85 | 2.00 | n/a | n/a | |||
| SRF_HUMAN | -2.99 | 2.28 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP coronary artery disease (cad), hdl cholesterol, ldl cholesterol, total cholesterol, triglycerides