rs790601 chr6:90393289 G>A
- Sequence
tgtaccatgtttagcatgtctgct[G/A]tgtagaatctagctcatcaaatgt
- ASB in cell types
- K562 (myelogenous leukemia) 22RV1 (prostate carcinoma) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.73 | -0.09 | 1.99 | |||
| 22RV1 (prostate carcinoma) | -0.73 | 0.77 | 1.00 | |||
| A549 (lung carcinoma) | 0.32 | 0.47 | 1.15 |
Items per page:
1 – 3 of 3