rs791357 chr5:173778222 T>C
- Sequence
aaaatcaggaagcttagaccagtg[T/C]tgtggaaccttgattcctgtccca
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ATF4_HUMAN ARI1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ATF4_HUMAN | 2.34 | -3.38 | 2.00 | n/a | No Hit | |||
| ARI1B_HUMAN | n/a | 2.11 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
EMBL-EBI granulocyte count, myeloid white cell count, neutrophil count, sum basophil neutrophil counts, sum neutrophil eosinophil counts
GRASP diastolic blood pressure (dbp), hdl cholesterol, hip bone mineral density (bmd), obesity with early age of onset (age >2), schizophrenia, spine bone mineral density (bmd), systolic blood pressure (sbp)