rs7921051 chr10:29409522 G>A
- Sequence
gcgggggaattctgggagtgcgcg[G/A]ccttggagcgcgcacatgcgcggc
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells)
- ASB for transcription factors
- IKZF1_HUMAN KDM1A_HUMAN IKZF2_HUMAN MNT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | 1.43 | -0.15 | 1.78 | n/a | No Hit | |||
| KDM1A_HUMAN | 1.87 | -0.93 | 2.00 | n/a | n/a | |||
| IKZF2_HUMAN | 1.63 | -0.62 | 1.33 | n/a | n/a | |||
| MNT_HUMAN | 1.70 | -0.74 | 2.00 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, ldl cholesterol change with statins, total cholesterol change with statins, triglycerides
GTEx eQTL Artery_Coronary, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Muscle_Skeletal, Nerve_Tibial, Testis