rs79298 chr22:50030504 G>T
- Sequence
cgcagcacaggctccagcgggtgc[G/T]catttagctggtttggatcccagc
- ASB in cell types
- CD14+ monocytes MDA-MB-453 (breast adenocarcinoma) PC9 (lung adenocarcinoma) liver
- ASB for transcription factors
- STAT1_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.25 | n/a | 2.50 | n/a | No Hit | |||
| ANDR_HUMAN | 1.94 | -1.24 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, ldl cholesterol, longstanding arthritis, obesity with early age of onset (age >2), schizophrenia