rs7937654 chr11:126491436 T>C
- Sequence
tggctgagaactaattcaaggcca[T/C]gtgactctggctaaagcctgcatc
- ASB in cell types
- Ishikawa (endometrial adenocarcinoma)
- ASB for transcription factors
- USF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| USF1_HUMAN | -2.53 | 2.44 | 1.33 | 4.03 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP fasting insulin, hdl cholesterol, homa-b, homa-ir, salmonella-induced pyroptosis, serum creatinine, systolic blood pressure (sbp)