rs7944145 chr11:128568530 A>G
- Sequence
aaaggtcatccctcccacacaatg[A/G]ccagacaacttcccaaagtgttgc
- ASB in cell types
- periferal blood macrophages
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -1.18 | 1.61 | 2.10 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP height, major depressive disorder, mitral annular calcium, panic disorder, refractive error, serum creatinine