rs7947832 chr11:81874808 T>G
- Sequence
agcactgagagaaccagcactcca[T/G]cacatctgtcagtcttttgaggct
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- PKNX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PKNX1_HUMAN | 1.55 | -1.81 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1