rs7951076 chr11:3869623 G>A
- Sequence
gtttagattggctggagagtggta[G/A]ctgtgccagagagtaccataaaaa
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.37 | 0.48 | 2.17 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, ldl cholesterol, neuroblastoma (brain cancer), obesity with early age of onset (age >2), sporadic creutzfeldt-jakob disease
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Nerve_Tibial, Whole_Blood