rs7951543 chr11:34052098 G>C
- Sequence
ccctccccggtagggaccgttgca[G/C]tggccgttggcggccggcgcggcg
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.04 | 0.86 | 1.99 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellum, Brain_Cortex, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg