rs79525044 chr16:4227476 A>G
- Sequence
gataagtgaatggatgatgggtgg[A/G]tgaatggatagatgagtggatggg
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.71 | -0.31 | 2.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.03 | 0.73 | 1.96 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Cells_Cultured_fibroblasts, Nerve_Tibial, Pituitary, Prostate, Thyroid