rs7954135 chr12:24960312 T>C
- Sequence
gaggccatatggcatggagagaga[T/C]tctatatgcttaggggaggaagag
- ASB in cell types
- PC9 (lung adenocarcinoma) VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PC9 (lung adenocarcinoma) | -2.04 | 2.25 | 2.00 | |||
| VCaP (prostate carcinoma) | -0.79 | 0.91 | 1.00 |
Items per page:
1 – 2 of 2