rs7954558 chr12:53244353 G>A
- Sequence
gcctcccaaagtgctaggatcaca[G/A]gtgtaagccactgcacctgaccac
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.83 | -0.13 | 2.01 | |||
| HEK293 (embryonic kidney) | -0.17 | 0.69 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Hypothalamus, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood