rs7958582 chr12:41984142 G>A
- Sequence
agaatcattgagtaaaactaatat[G/A]ttacattgtatgtttctgatttcc
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- PRDM6_HUMAN OSR2_HUMAN SP7_HUMAN FEZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PRDM6_HUMAN | 0.98 | n/a | 2.00 | n/a | No Hit | |||
| OSR2_HUMAN | 2.54 | n/a | 2.00 | n/a | No Hit | |||
| SP7_HUMAN | 2.39 | -3.65 | 2.00 | n/a | n/a | |||
| FEZF1_HUMAN | 2.38 | n/a | 2.00 | n/a | No Hit | |||
| PRDM4_HUMAN | 2.38 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 7
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, hdl cholesterol change with statins, rheumatoid arthritis, variant creutzfeldt-jakob disease
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Thyroid, Whole_Blood