rs7959391 chr12:7832278 G>A
- Sequence
aatatcccagtaggtggcagcact[G/A]atgttcaccccagccctctgctaa
- ASB in cell types
- erythroid progenitors neural cell HEK293 (embryonic kidney) OVCAR8 (high grade ovarian serous adenocarcinoma)
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.90 | 0.89 | 1.40 | n/a | No Hit | |||
| RAD21_HUMAN | 1.08 | -0.46 | 1.39 | n/a | n/a |
Items per page:
1 – 2 of 2