rs7961894 chr12:121927677 C>T
- Sequence
taatttcttgctgtcacacaaggt[C/T]ctacagtgaacgtgctcctccatc
- ASB in cell types
- monocyte-derived macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived macrophages | 1.26 | n/a | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, chronic kidney disease, coronary artery disease (cad), maternal transmission distortion, mean erythrocyte volume, mean platelet volume (mpv), mean platelet volume (mpv) (fl), log, platelet count (plt), platelet count (plt) (10^9/l), transmission distortion
PheWAS abnormal involuntary movements, acquired foot deformities, acquired toe deformities, adjustment reaction, althetes foot, anaphylactic shock nos, anisometropia, anterior pituitary disorders, anxiety disorder, anxiety, phobic and dissociative disorders, aplastic anemia, aseptic necrosis of bone, attention deficit hyperactivity disorder, back pain, benign neoplasm of breast, benign neoplasm of ovary, bullous dermatoses, cardiac arrhythmia nos, cellulitis and abscess of foot/toes, colles fracture, colon cancer, colorectal cancer, complications of transplants and reattached limbs, concussion, corneal dystrophy, decreased libido, decubitus ulcer, deep vein thrombosis, deficiency anemias nos, degeneration of intervertebral disc, dermatophytosis, dermatophytosis / dermatomycosis, diseases of nail, diseases of sebaceous glands, disorders of coccyx, disorders of fluid, electrolyte, and acid-base balance, disorders of parathyroid gland, disorders of the autonomic nervous system, dysphagia, dysuria, electrolyte imbalance, enthesopathy, exophthalmos, fluid overload, gastric ulcer, generalized anxiety disorder, generalized hyperhidrosis, glossodynia, hammer toe, hemorrhage of rectum and anus, hemorrhage or hematoma complicating a procedure, herpes zoster with nervous system complications, iatrogenic hypotension, injuries to the nervous system, intervertebral disc disorders, loss of teeth or edentulism, mastodynia, mental retardation, multiple myeloma, noninflammatory disorders of vulva and perineum, nonrheumatic pulmonary valve disorders, osteopenia, other diseases of the teeth and supporting structures, other disorders of back, other open wound of head and face, other specified diseases of nail, other specified disorders of plasma protein metabolism, pain in joint, pancytopenia, peptic ulcer, pericarditis, peripheral autonomic neuropathy, personal history of allergy to medicinal agents, personality disorders, pervasive developmental disorders, plasma protein metabolism disorder, poisoning by anticonvulsants and anti-parkinsonism drugs, poisoning by hormones and synthetic substitutes, posttraumatic stress disorder, prolapse of vaginal vault after hysterectomy, pseudoexfoliation glaucoma, pseudomonal pneumonia, seborrhea, sexual and gender identity disorders, stricture/obstruction of ureter, subjective visual disturbances, thyroid cancer, toxic effect of venom, type 1 diabetes, type 1 diabetes nephropathy, type 1 diabetic retinopathy, type 2 diabetic ketoacidosis, type 2 diabetic neuropathy, ulceration of intestine, unspecified osteomyelitis, vaginal enterocele, congenital or acquired, visual disturbances, visual field defects, vitamin b-complex deficiencies, vitamin deficiency
GTEx eQTL Artery_Coronary, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood