rs79621608 chr1:1471591 C>G
- Sequence
ttttgtcccggtgcggctccggta[C/G]ccagacgcttcaccacgccccccg
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.19 | 0.58 | 1.35 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Lung, Skin_Not_Sun_Exposed_Suprapubic, Thyroid