rs7965013 chr12:120647034 G>A
- Sequence
tttccatagggaccaggttttgcc[G/A]gctcctgtctcctgtttccaacga
- ASB in cell types
- foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.33 | n/a | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Colon_Sigmoid, Esophagus_Muscularis, Nerve_Tibial, Testis, Thyroid