rs796513 chr12:69671846 G>A
- Sequence
tcaaaccacacactctagagtgga[G/A]ttgcctcttagctggagggagggg
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.19 | 0.71 | 2.04 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, maternal transmission distortion, neuroblastoma (brain cancer), parkinsons disease, transmission distortion
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Tibial, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Testis