rs79673968 chr1:166876710 T>A
- Sequence
ctaaccgtctcatatgacatttag[T/A]tgatttatcttgtaaatgttatgg
- ASB in cell types
- foreskin keratinocyte H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 2.18 | -3.14 | 2.00 | |||
| H929 (plasma cell myeloma) | -2.39 | 2.16 | 1.50 |
Items per page:
1 – 2 of 2