rs7973392 chr12:1115806 A>C
- Sequence
ttgtgactcagatctgtgaaagat[A/C]cagataagaggtgtttgttttatt
- ASB in cell types
- SK-N-SH (neuroblastoma)
- ASB for transcription factors
- GATA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA3_HUMAN | 1.77 | -1.42 | 1.33 | -3.38 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
