rs797387 chr14:34060107 C>T
- Sequence
ggacaatcgaaatgatcaaaaatg[C/T]ccggcgggcagccttggcgagcgc
- ASB in cell types
- HEK293T (embryonic kidney) MCF7 (Invasive ductal breast carcinoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293T (embryonic kidney) | -0.48 | 1.39 | 2.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.75 | 0.30 | 1.56 | |||
| HEK293 (embryonic kidney) | 0.12 | 0.67 | 1.61 |
Items per page:
1 – 3 of 3