rs797773 chr12:6198400 C>T
- Sequence
tctctaggctttatcccattgccc[C/T]gccttcattcattcttctctcacc
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.64 | -0.25 | 2.01 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, cognitive response to topiramate treatment as measured by the animals cognitive test, cystatin c in serum, resistance to kuru in aged women despite likely exposure, variant creutzfeldt-jakob disease