rs798585 chr3:118792668 G>A
- Sequence
ccttagaccaaaccaaacctgccc[G/A]gtgcttagaaacctgatcatcatc
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF2_HUMAN | 2.10 | n/a | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, chronic kidney disease, infant head circumference, triglycerides