rs798949 chr7:121125900 T>C
- Sequence
accctgtagtgctccaggtcagta[T/C]gccaaaggcctcatgtgagcttct
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.59 | 0.00 | 1.55 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, alcohol dependence symptoms, ldl cholesterol change with statins, total body bone mineral density (bmd), total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Muscularis