rs798974 chr13:32164928 C>A
- Sequence
cttcctgcagtgctttgcatgcac[C/A]aagggcttgctgttgagtattcac
- ASB in cell types
- 786-O (renal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 786-O (renal carcinoma) | 1.92 | -0.24 | 1.75 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP decrease in fev1 (in asthmatic participants >=30 years old), decrease in fev1 (in asthmatic participants), fasting insulin, homa-ir, mitral annular calcium, systolic blood pressure (sbp), triglycerides