rs799488 chr14:34982204 T>C
- Sequence
aataaaatccctcttcttgtatac[T/C]agggctcgctcttgttaattggtg
- ASB in cell types
- GM12878 (female B-cells) breast tumor tissue
- ASB for transcription factors
- FOXK2_HUMAN ESR1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXK2_HUMAN | -2.63 | 2.04 | 1.50 | n/a | n/a | |||
| ESR1_HUMAN | n/a | 2.00 | 2.50 | n/a | No Hit | |||
| CTCF_HUMAN | 0.23 | 0.76 | 1.39 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, major depressive disorder, obesity with early age of onset (age >2), refractive error
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Hippocampus, Brain_Hypothalamus, Brain_Putamen_basal_ganglia, Brain_Substantia_nigra, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood