rs79989256 chr16:69396011 T>C
- Sequence
ttttgtagagagggggtcttgcta[T/C]attgccctgactggtctcaaactc
- ASB in cell types
- HEK293 (embryonic kidney) OCI-LY7 (diffuse large B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.02 | 0.60 | 1.76 | |||
| OCI-LY7 (diffuse large B-cell lymphoma) | 0.96 | -0.74 | 1.11 |
Items per page:
1 – 2 of 2