rs799976 chr7:80453775 T>G
- Sequence
ttataatatactactgagttaaag[T/G]caaaaaatatactatgattcttaa
- ASB in cell types
- PC9 (lung adenocarcinoma) IPSC-derived bipolar neuron foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PC9 (lung adenocarcinoma) | 2.64 | n/a | 2.00 | |||
| IPSC-derived bipolar neuron | -0.28 | 1.64 | 1.33 | |||
| foreskin keratinocyte | -1.13 | 1.45 | 1.67 |
Items per page:
1 – 3 of 3