rs80050718 chr10:1368680 G>T
- Sequence
ctctctctctggttggcaaggcaa[G/T]aattcgttctcacaaaaccttcca
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- RFX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFX1_HUMAN | n/a | 2.47 | 2.00 | -0.29 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
