rs8007304 chr14:92570226 T>G
- Sequence
agggccaggggtcaaagtttgcct[T/G]cccaggggcaccactggctcctgc
- ASB in cell types
- cranial neural crest cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| cranial neural crest cells | -2.37 | 1.88 | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, diastolic blood pressure (dbp), neuroblastoma (brain cancer), premature ovarian failure, serum creatinine, systolic blood pressure (sbp)