rs8013113 chr14:89430998 T>C
- Sequence
aacctcagactgtgccaaactcca[T/C]ctccatttaaggaaaatggttttc
- ASB for transcription factors
- SRF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SRF_HUMAN | 0.53 | -0.66 | 1.33 | -1.87 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP 2 hour glucose, alcohol dependence, alcohol dependence (early age of onset), alzheimers disease, birth weight, comorbid depressive syndrome and alcohol dependence, eye color, height, homa-b, late onset alzheimers disease, waist hip ratio