rs801631 chr22:46769414 A>G
- Sequence
gctgagcaagccatgtggctcttc[A/G]cggctggacgcctgccctgtgaac
- ASB in cell types
- GM12878 (female B-cells) HEK293 (embryonic kidney)
- ASB for transcription factors
- FOXK2_HUMAN ZIC2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXK2_HUMAN | 2.06 | -1.79 | 1.33 | n/a | n/a | |||
| ZIC2_HUMAN | 2.38 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid