rs8019703 chr14:106492111 C>G
- Sequence
acagaaggctcgcagtcttgtctt[C/G]tggtcacttctcaccatgtccctt
- ASB in cell types
- erythroid progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid progenitors | 1.93 | n/a | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Colon_Transverse, Esophagus_Mucosa, Lung, Small_Intestine_Terminal_Ileum, Spleen, Testis, Whole_Blood