rs8024847 chr15:53072383 T>G
- Sequence
tcagtaccctggacagctcctggg[T/G]tcaggtctcctggcagctgcctct
- ASB in cell types
- HepG2 (hepatoblastoma) Ishikawa (endometrial adenocarcinoma) cranial neural crest cells K562 (myelogenous leukemia)
- ASB for transcription factors
- NR2F6_HUMAN COT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NR2F6_HUMAN | -3.09 | 2.59 | 1.50 | n/a | n/a | |||
| COT1_HUMAN | n/a | 2.22 | 2.50 | n/a | No Hit |
Items per page:
1 – 2 of 2