rs80321947 chr17:72727865 C>T
- Sequence
gaggaagtaacggcatctgtacac[C/T]agatggcagcagccacacacacat
- ASB in cell types
- HepG2 (hepatoblastoma) R3/R4 erythroid cells fibroblast of mammary gland MM1.S (plasma cell myeloma)
- ASB for transcription factors
- CTCF_HUMAN GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.28 | 0.47 | 1.70 | -1.36 | Weak Concordant | |||
| GATA1_HUMAN | 1.95 | -1.74 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
