rs8036635 chr15:67953150 T>G
- Sequence
tctctgtactttctactcagtttt[T/G]ttgtgaacccaaaactgtcctaaa
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ZN555_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN555_HUMAN | 2.88 | -3.61 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), body mass index (bmi), obesity with early age of onset (age >2), parkinsons disease
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Nerve_Tibial, Thyroid, Whole_Blood