rs8043731 chr16:57290201 G>T
- Sequence
ctgctctgaccttatccccactgc[G/T]tactgggcctgcccagctgtggcc
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 1.20 | -0.21 | 2.08 | |||
| HEK293 (embryonic kidney) | 0.63 | -0.01 | 1.69 |
Items per page:
1 – 2 of 2