rs8045108 chr16:2023054 C>G
- Sequence
gttctcgcggggctggcggggggg[C/G]gttcagtgatgttccctggtgctt
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.14 | 0.72 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.16 | 0.77 | 1.92 | |||
| foreskin keratinocyte | 1.55 | 0.53 | 2.50 |
Items per page:
1 – 3 of 3