rs804987 chr3:120596197 G>A
- Sequence
cttcgcgcatgcgcatatcaccga[G/A]cgaacgcgccgtgttcgggaaggt
- ASB in cell types
- CD14+ monocytes GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD14+ monocytes | 2.02 | -3.95 | 2.50 | |||
| GM12878 (female B-cells) | 0.58 | 0.42 | 1.28 |
Items per page:
1 – 2 of 2