Attention! You are using release Soos. You can switch to the latest ADASTRA version: adastra.autosome.org

rs805294 chr6:31720440 A>G

Sequence
aggcccacgccctacatatcttcc[A/G]tcactccaccccgtttggaggtga
ASB in cell types
MCF7 (Invasive ductal breast carcinoma)

Color scale

color scale ref
-log10 FDR of Ref (A) ASB
color scale alt
-log10 FDR of Alt (G) ASB

Details

Cell type
Effect size Ref
Effect size Alt
FDR Ref
FDR Alt
Mean BAD
MCF7 (Invasive ductal breast carcinoma) 0.57 0.20 0.020.92 1.28
Items per page:
1 – 1 of 1

Motif analysis

No data available

Genetic associations

GRASP alopecia areata diabetic retinopathy in type 2 diabetes mellitus diastolic blood pressure (dbp) fasting insulin hdl cholesterol hdl cholesterol change with statins idiopathic membranous nephropathy lp-pla2 activity primary biliary cirrhosis primary biliary cirrhosis (antimitochondrial-antibody positive only) rheumatoid arthritis salmonella-induced pyroptosis schizophrenia serum creatinine systolic blood pressure (sbp) tetrology of fallot type 1 diabetes type 1 diabetes, combined control dataset, gender differentiated
GTEx eQTL Adipose_Subcutaneous Adipose_Visceral_Omentum Adrenal_Gland Artery_Aorta Artery_Coronary Artery_Tibial Brain_Amygdala Brain_Anterior_cingulate_cortex_BA24 Brain_Caudate_basal_ganglia Brain_Cerebellar_Hemisphere Brain_Cerebellum Brain_Cortex Brain_Frontal_Cortex_BA9 Brain_Hippocampus Brain_Hypothalamus Brain_Nucleus_accumbens_basal_ganglia Brain_Putamen_basal_ganglia Brain_Spinal_cord_cervical_c-1 Breast_Mammary_Tissue Cells_Cultured_fibroblasts Cells_EBV-transformed_lymphocytes Colon_Sigmoid Colon_Transverse Esophagus_Gastroesophageal_Junction Esophagus_Mucosa Esophagus_Muscularis Heart_Atrial_Appendage Heart_Left_Ventricle Liver Lung Minor_Salivary_Gland Muscle_Skeletal Nerve_Tibial Pancreas Pituitary Prostate Skin_Not_Sun_Exposed_Suprapubic Skin_Sun_Exposed_Lower_leg Small_Intestine_Terminal_Ileum Spleen Stomach Testis Thyroid Vagina Whole_Blood

Download