rs8053361 chr16:5634234 C>T
- Sequence
tacctgacagctactggttcagta[C/T]tggcaaagcctgaagtcttgtcct
- ASB for transcription factors
- SMC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMC3_HUMAN | -1.13 | 1.44 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP height, total cholesterol, total cholesterol change with statins, triglycerides change with statins