rs8056661 chr16:84277646 C>G
- Sequence
ctcacctcactgcagcctcaacct[C/G]ctgggctcaagcaatcctcccacc
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.60 | 0.73 | 2.66 | |||
| foreskin keratinocyte | 1.99 | -0.15 | 3.00 |
Items per page:
1 – 2 of 2