rs805787 chr7:123580894 G>A
- Sequence
agtgttgaagcttggtcagagacc[G/A]ttcggttaagtctattatgaaaag
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) RWPE1 (prostate epithelial cells) MM1.S (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.65 | 0.17 | 1.52 | |||
| HEK293 (embryonic kidney) | -0.21 | 0.72 | 1.95 | |||
| RWPE1 (prostate epithelial cells) | 2.46 | n/a | 2.00 | |||
| MM1.S (plasma cell myeloma) | -1.16 | 1.29 | 2.00 |
Items per page:
1 – 4 of 4