rs8060798 chr16:27313559 A>C
- Sequence
attccagtcgcccagccctccccc[A/C]ccaaacgcaactgccccggcgcaa
- ASB in cell types
- HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.15 | 0.80 | 1.94 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.61 | 0.31 | 1.78 | |||
| HepG2 (hepatoblastoma) | 0.87 | -0.28 | 2.49 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Lung, Nerve_Tibial, Testis, Thyroid, Whole_Blood