rs8064009 chr16:13036823 T>C
- Sequence
cccccagtactaaatgaggtaaag[T/C]agttagcacaaatctggcaacagt
- ASB in cell types
- K562 (myelogenous leukemia) HCT-116 (colon carcinoma) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.44 | 0.83 | 2.00 | |||
| HCT-116 (colon carcinoma) | 1.84 | -0.67 | 1.33 | |||
| GM12878 (female B-cells) | 0.15 | 0.73 | 1.33 |
Items per page:
1 – 3 of 3